Review





Similar Products

86
Sangon Biotech primer 3 plus
Primer 3 Plus, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/0+5+primer+software/pm42301356-71-9-16
Average 86 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

98
TaKaRa 3 smart seq cds primer iia
3 Smart Seq Cds Primer Iia, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/SMART-Seq+v4+PLUS+Kit/us12629681-230-13-22
Average 98 stars, based on 1 article reviews
3 smart seq cds primer iia - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

86
Kuraray Noritake Dental solvent acetone ceramic primer clearfil ceramic primer plus kuraray noritake 3 methacryloxypropyl trimethoxysilane
Solvent Acetone Ceramic Primer Clearfil Ceramic Primer Plus Kuraray Noritake 3 Methacryloxypropyl Trimethoxysilane, supplied by Kuraray Noritake Dental, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/ceramic+primer/pm41277379-66-49-57
Average 86 stars, based on 1 article reviews
solvent acetone ceramic primer clearfil ceramic primer plus kuraray noritake 3 methacryloxypropyl trimethoxysilane - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Premier Biosoft primer 3 plus
Primer 3 Plus, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/5+premier+primer/10__3390_slash_fishes10050205-108-5-8
Average 86 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
PrimerDesign Inc primer 3 plus
Primer 3 Plus, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/primer3/pmc11769096-107-14-0
Average 90 stars, based on 1 article reviews
primer 3 plus - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

98
Toyobo mena seq4 5 3 150 taccgtgattatttgtccgc primers
Mena Seq4 5 3 150 Taccgtgattatttgtccgc Primers, supplied by Toyobo, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/KOD+-Plus-+Neo/pm39544141-63-15-24
Average 98 stars, based on 1 article reviews
mena seq4 5 3 150 taccgtgattatttgtccgc primers - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

90
Biotechnology Information primer-blast software version primer 3 plus
Primer Blast Software Version Primer 3 Plus, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+3+plus/primer+blast+software+version+primer+3+plus/pmc11591826-111-4-13
Average 90 stars, based on 1 article reviews
primer-blast software version primer 3 plus - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results